tb osseuse

tb osseuse

outils de l’article

Sujets:

chiffres

(juin ) Pliez changement de numéro de ostéoclastes et (b ) Noyaux par ostéoclastes après 24 h treatment des préostéoclastes Humains with 100 pg ml -1 de natif, désialylés (ds) ous déglycosylée (dg) monomère (IgG) ous complexée (IC) IgG humaine groupée. TRAP cellules -positif with ≥3 noyaux were considérés COMME DES ostéoclastes. Les barres indiquent la moyenne ± S.E.M. .. de Cinq expériences Indépendantes. (c ) Représentatifs micro-images. Barre d’échelle, 100 um. ( ) Pliez le changement de la zone résorbée après 24 h treatment des préostéoclastes Humains with 100 pg ml -1 de Natifs désialylés de Ou (ds) complexes IgG (IC) en calcium de phosphate puits revêtues. Les barres indiquent la moyenne ± S.E.M. .. de Cinq expériences Indépendantes (e ) Représentatifs micro-images. Barre d’échelle, 500 um. L’analyse statistique réalisée was with de Mann-Whitney U -testeur. **P &# X3C; 0,01.

(juin ) RT-PCR quantitative versez les levels d’ARNm de FcyR relatifs et de Protéines adaptatrices sur la are normalisées β2-microglobuline LORs ostéoclastogénèse. Jour 0 representé le Stade de monocytes, jour 6-8 l’Etape de fin préostéoclastes ET 10 jours au Stade des ostéoclastes matures. Les barres indiquent la moyenne ± S.E.M. .. de trois expériences Indépendantes. (b ) Des images de microscopie de fluorescence d’expression FcyR sur préostéoclastes humaines. FcyR are en vert représentés, coloration phalloïdine verser l’actine is Représenté in the coloration rouge et DRAQ5 verser les noyaux is Représenté en bleu. Barre d’échelle, 25 um (des images de représentants trois expériences Indépendantes). (c ) Replier changement du Nombre d’ostéoclastes après stimulation de pré-ostéoclastes with 100 pg ml-1 de complexes immuns (IC désialylés-DS) en présence de 10 ug ml-1 d’anticorps bloquants contre FcyR INDIQUE. TRAP cellules -positif with ≥3 noyaux were considérés COMME DES ostéoclastes. Les barres indiquent la moyenne ± S.E.M. .. de Quatre expériences Indépendantes. L’analyse statistique réalisée was with de Mann-Whitney U -testeur. *P &# X3C; 0,5, **P &# X3C; 0,01, ***P &# X3C 0001.

(juinc ) Paramêtres morphométriques osseuse, y compris le volume de par le volume osseux de tissu (BV / TV), numéro de trabéculaire (Tb.N) et de l’Épaisseur trabéculaire (Tb.Th) des PR de patients à Faible, moyen ous Élevé les levels de Fc (juin ) Sialylation (b ) Galactosylation ous (c ) Fucosylation Du total des IgG et APAC. Les Barres indiquent la Moyenne ± S.E.M. .. patients de10 Dans each tertile. Cutoffs verser tertiles Sont Les Suivantes: IgG Fc sialylation (Faible: &# X3C; 14%, moyenne: 15 à 17,5%, Élevé: &# X0003E; 17,5%), l’APAC Fc sialylation (&# X3C; 12%; 12 à 16%; &# X0003E; 16%), IgG Fc galactosylation (&# X3C; 43,5%; 43,5 à 51%; &# X0003E; 51%); APAC Fc galactosylation (&# X3C; 44%; 44 à 54,5%; &# X0003E; 54,5%); Fc d’IgG fucosylation (&# X3C; 85%; 85 à 87%; &# X0003E; 87%); APAC Fc fucosylation (&# X3C; 93%; 93-96%; &# X0003E; 96%). ( ) Bidimensionnelle (panneau supérieur) ET Trois dimensions (les inférieurs de la reconstruction) Panneaux de l’architecture osseuse des patients Ayant le degré de sialylation Fc de haute et basse; (e ) Pliez changement de numéro de ostéoclastes après treatment de préostéoclastes pendant 72 h with 10 pg ml -1 native, galactosylée (gal) ous galactosylée et sialylé (sial) monoclonal APAC (clone 109 et C7). TRAP cellules -positif with ≥3 noyaux were considérés COMME DES ostéoclastes. Les barres indiquent la moyenne ± S.E.M. .. de trois expériences Indépendantes. L’analyse statistique réalisée was with the test de Kruskal-Wallis correction with de Dunn (juinc ) Et de Mann-Whitney U -test (e). *P &# X3C; 0,5, **P &# X3C; 0,01.

(juin ) Quantification de sérum totale IgG1 Fc sialylation et galactosylation au jour 32 Chez des Souris et donnes Souris Témoins non-induites induite par LA CIA Recevant non treatment with de l’eau. 10 g l -1 ous mannose 10 g l -1 ManNAc. (b ) Incidence de la CIA. (c ) Les points d’arthrite. ( ) Images représentants des pattes postérieures au jour 32. La barre d’échelle, 5 mm. (e ) Quantification de l’IgG sérique totale et collagène IgG Spécifiques au jour 32. Les barres indiquent la moyenne ± S.E.M. .. DES DONNEES Provenant de deux expériences Indépendantes (non induite par groupe de Contrôle combiné: n = 9; souris TOUS les Autres Groupes: n = 13) souris. (F ) Quantification de sérum totale IgG1 Fc sialylation et galactosylation au jour 32 chez des souris Qui sont RESTES l’arthrite légère Saine ous développés (score 0-4) et de souris Qui Ont Développé juin arthrite sévère (score &# X0003E; 4). Les barres indiquent la moyenne ± S.E.M. .. DES DONNEES COMBINEES de Toutes Les souris Soumises à la CIA (score 0-4: n = 13; Mais &# X0003E; 4: n = 25). L’analyse statistique réalisée was with de Mann-Whitney U -testeur. *P &# X3C; 0,5, **P &# X3C; 0,01.

(juin ,b ) Représentatifs des reconstructions en 3 dimensions de l’architecture de l’os de la patte de derrière (juin ) Et les os tibial (b ) Des souris non-induite et des Contrôle souris induites Pour l’arthrite induite par le collagène (CIA) traitées with de l’eau. 10 g l -1 ous mannose 10 g l -1 ManNAc. (c ) Paramêtres morphométriques osseuse du tibia Dont trabéculaire et le volume de l’os de volume par corticale de tissu (TBV / TV; CBV / TV) et trabéculaire et de la densité minérale osseuse corticale (TBMD; cBMD). Les barres indiquent la moyenne ± S.E.M. .. Une expérience représentative (non induit groupe témoin: n = 5; souris eau groupe Traité: n = 7; souris TOUS les Autres Groupes n = 6 souris). ( ) Images de représentants TRAP -stained sections de patte. Barre d’échelle, 200 um. (e ) paramêtres histologiques des Pattes arrieres y COMPRIS la zone par zone de Tissu (E.Ar/T.Ar~~number=plural) ET Le Nombre D’ostéoclastes zone par de Tissu (N.Oc / T.Ar) ÉRODE. Les barres indiquent la moyenne ± S.E.M. .. DES DONNEES Provenant de deux expériences Indépendantes (non induite par groupe de Contrôle combiné: n = 9; souris TOUS les Autres Groupes: n = 13) souris. L’analyse statistique réalisée was with de Mann-Whitney U -testeur. **P &# X3C; 0,01.

Dans this study, Nous Avons used la chaleur IgG agrégée Comme un mimétique sans complexe de restrictions d’immunitaire Antigène 22 verser etudier les Effets des IgG sialylation-sur les interactions complexes immunitaires ostéoclastes. Nous Avons found IgG sialylation Être non régulateur principale versez Le Potentiel pro-ostéoclastogénique de complexes immuns Que les non Seuls ostéoclastogenèse sialylées immuns complexes stimulés in vitro also bien Que in vivo,. De plus, Nous Avons Trouvé, plus Eleves Fc levels de sialylation des Deux IgG aléatoire AINSI Que des autoanticorps Spécifiques Pour Etre en corrélation Avec le volume de plus de osseux chez Élevé les de PR de patients. administration L’du sialique précurseur d’acide ManNAc non résultait des only rate of sialylation Eleves d’IgG, Mais aussi d’juin diminution de la sensibilité à l’arthrite induite par le collagène (CIA) D’une érosion osseuse médiée Dans DBA / 1J souris, Ce Qui suggested non rôle protecteur de la sialylé IgG contre auto-immune à médiation par Une perte osseuse.

immuncomplexes désialylés ostéoclastogenèse stimulent

La stimulation nominale des complexes immuns (IC désialylés-DS) a entrainé juin accélération de l’ostéoclastogenèse Avec Une augmentation du Nombre d’ostéoclastes, les noyaux par des ostéoclastes et la résorption osseuse (Fig. 1). En revanche, la stimulation après de juin with (sialylées) des complexes immuns (IC) non traitées, sur un OBSERVER Qu’une tendance très Faible à des nombres ainsi Eleves d’ostéoclastes et Aucune différence Dans la résorption osseuse. Ni les complexes immuns (IC déglycosylées-dg) ni les IgG monomères have Montré non effet, Ce Qui juin Indique l’interaction Spécifique Entre les complexes immuns non sialylées et FcyR sur préostéoclastes. This effet pro-ostéoclastogénique des des complexes de sialylé Faible IgG a ete confirmée par des complexes immuns NATURELS CONSTITUE nominale des bas ous de haut-sialylé anti-PNT IgG et PNT-26-BSA (figure additional. 3).

Figure 1: Fc-glycosylation déterminons les les Humains de complexes de effets sonores.

(juin ) Pliez changement de numéro de ostéoclastes et (b ) Noyaux par ostéoclastes après 24 h treatment des préostéoclastes Humains with 100 pg ml -1 de natif, désialylés (ds) ous déglycosylée (dg) monomère (IgG) ous complexée (IC) IgG humaine groupée. TRAP cellules -positif with ≥3 noyaux were considérés COMME DES ostéoclastes. Les barres indiquent la moyenne ± S.E.M. .. de Cinq expériences Indépendantes. (c ) Représentatifs micro-images. Barre d’échelle, 100 um. ( ) Pliez le changement de la zone résorbée après 24 h treatment des préostéoclastes Humains with 100 pg ml -1 de Natifs désialylés de Ou (ds) complexes IgG (IC) en calcium de phosphate puits revêtues. Les barres indiquent la moyenne ± S.E.M. .. de Cinq expériences Indépendantes (e ) Représentatifs micro-images. Barre d’échelle, 500 um. L’analyse statistique réalisée was with de Mann-Whitney U -testeur. **P &# X3C; 0,01.

Les complexes immuns se LIENT à FcyRII et III préostéoclastes de-sur

Figure 2: FcyRII et III médiatisent le Signal de complexes non sialylé immunitaires sur préostéoclastes.

(juin ) RT-PCR quantitative versez les levels d’ARNm de FcyR relatifs et de Protéines adaptatrices sur la are normalisées β2-microglobuline LORs ostéoclastogénèse. Jour 0 representé le Stade de monocytes, jour 6-8 l’Etape de fin préostéoclastes ET 10 jours au Stade des ostéoclastes matures. Les barres indiquent la moyenne ± S.E.M. .. de trois expériences Indépendantes. (b ) Des images de microscopie de fluorescence d’expression FcyR sur préostéoclastes humaines. FcyR are en vert représentés, coloration phalloïdine verser l’actine is Représenté in the coloration rouge et DRAQ5 verser les noyaux is Représenté en bleu. Barre d’échelle, 25 um (des images de représentants trois expériences Indépendantes). (c ) Replier changement du Nombre d’ostéoclastes après stimulation de pré-ostéoclastes with 100 pg ml-1 de complexes immuns (IC désialylés-DS) en présence de 10 ug ml-1 d’anticorps bloquants contre FcyR INDIQUE. TRAP cellules -positif with ≥3 noyaux were considérés COMME DES ostéoclastes. Les barres indiquent la moyenne ± S.E.M. .. de Quatre expériences Indépendantes. L’analyse statistique réalisée was with de Mann-Whitney U -testeur. *P &# X3C; 0,5, **P &# X3C; 0,01, ***P &# X3C 0001.

immuncomplexes désialylés ostéoclastes affectent in vivo,

Nous Avons ensuite Voulu enquêter-sur les implications dé complexes immuns désialylés sur ostéoclastogenèse in vivo,. Chez les patients atteints de polyarthrite rhumatoïde, les complexes immuns were trouvés in the liquide synovial de l’espace articulaire 24. 25. 26. Verser la situation this Simuler, Nous Avons Décidé d’injecter murins-IgG agrégée Dans les articulations du genou de souris C57BL / 6. Encore une fois, une partie de l’IgG was enzymatiquement désialylée avant l’agrégation de la chaleur. Le groupe témoin was INJECTÉ with du PBS. Les injections were répétées au bout de 4 jours. Après 3 jours supplementaires, les os were disséqués et ANALYSES versez DETERMINER Le Nombre et la taille des ostéoclastes à l’os trabéculaire au lieu d’adjacentes injection.

Les Souris Sie have received juin injection de 5 ug de complexes immuns (IC désialylés-ds) affiche Un Certain Nombre d’ostéoclastes et la surface, plus significativement Elevée rapport par aux souris injectées PBS (Fig. 3a-c). L’injection de 5 ug de non (sialylés) Series complexes immuns (IC) a entrainé juin légère augmentation du Nombre d’ostéoclastes et la surface, but l’effet Était beaucoup Moins PRONONCE PAR désialylés immuns rapport aux complexes, notre confirmant in vitro Données. Including, this différence a disparu après la co-injection de 100 ng de TNFa. Dans mes CAS de bureaux, Les Deux agrégats ÉTAIENT capables d’induire ostéoclastogenèse déjà à juin quantity de 1 pg.

Figure 3: non sialylées de complexes ostéoclastogenèse stimulent in vivo,.

Hématoxyline-éosine a Révélé Aucune différence Dans le degré d’inflammation Entre les Groupes with only localisé, le CAS echeant, l’inflammation Autour de la petite lésion du site d’injection (Fig. 3d, e). Par Conséquent, l’effet pro-ostéoclastogénique OBSERVEE des complexes immuns désialylés Était indépendante de l’infiltration des tissus inflammatoires.

IgG glycosylation et la perte osseuse chez les patients atteints d’arthrite

Conformement à nos expériences Précédentes, les patients presentant des IgG Avec Des portions sialylées Faiblement OÜ peu galactosylée Fc affichent juin diminution du volume du significative par rapport aux osseux patients Ayant des levels Eleves d’IgG Fc sialylation ous galactosylation (Fig. 4a, b, d ). This effet Semble Être Principalement Liée au Nombre trabéculaire inférieurs, being Donné qu’aucune différence n’à was OBSERVEE Dans l’Épaisseur trabéculaire. Des Résultats similaires were obtenus versez l’APAC Spécifique de la maladie. L’analyse de Fc d’IgG et d’fucosylation juin APAC n’à Montré Aucune relation with la structure de osseuse (fig. 4c). En outré, il N’y Avait pas de différence Entre les Groupes en Ce Qui Concerne les Autres paramêtres impactant potentiellement l’Architecture osseuse ous IgG état de glycosylation 27. tells Que l’âge, le sexe, la Durée de la maladie, l ‘activité de la maladie ous de l’état de treatment (tableau complémentaire 1), Ce Qui suggested Que les différences Dans les os personnes observées la structure de IgG aux Était limitée sialylation et galactosylation.

Figure 4: état sialylation des IgG et APAC masse osseuse chez les Contrôle patients atteints de polyarthrite rhumatoïde.

(juinc ) Paramêtres morphométriques osseuse, y compris le volume de par le volume osseux de tissu (BV / TV), numéro de trabéculaire (Tb.N) et de l’Épaisseur trabéculaire (Tb.Th) des PR de patients à Faible, moyen ous Élevé les levels de Fc (juin ) Sialylation (b ) Galactosylation ous (c ) Fucosylation Du total des IgG et APAC. Les Barres indiquent la Moyenne ± S.E.M. .. patients de10 Dans each tertile. Cutoffs verser tertiles Sont Les Suivantes: IgG Fc sialylation (Faible: &# X3C; 14%, moyenne: 15 à 17,5%, Élevé: &# X0003E; 17,5%), l’APAC Fc sialylation (&# X3C; 12%; 12 à 16%; &# X0003E; 16%), IgG Fc galactosylation (&# X3C; 43,5%; 43,5 à 51%; &# X0003E; 51%); APAC Fc galactosylation (&# X3C; 44%; 44 à 54,5%; &# X0003E; 54,5%); Fc d’IgG fucosylation (&# X3C; 85%; 85 à 87%; &# X0003E; 87%); APAC Fc fucosylation (&# X3C; 93%; 93-96%; &# X0003E; 96%). ( ) Bidimensionnelle (panneau supérieur) ET Trois dimensions (les inférieurs de la reconstruction) Panneaux de l’architecture osseuse des patients Ayant le degré de sialylation Fc de haute et basse; (e ) Pliez changement de numéro de ostéoclastes après treatment de préostéoclastes pendant 72 h with 10 pg ml -1 native, galactosylée (gal) ous galactosylée et sialylé (sial) monoclonal APAC (clone 109 et C7). TRAP cellules -positif with ≥3 noyaux were considérés COMME DES ostéoclastes. Les barres indiquent la moyenne ± S.E.M. .. de trois expériences Indépendantes. L’analyse statistique réalisée was with the test de Kruskal-Wallis correction with de Dunn (juinc ) Et de Mann-Whitney U -test (e). *P &# X3C; 0,5, **P &# X3C; 0,01.

Pour définir le rôle des IgG sialylation in the Structure de l’os humain, influence sialylation Nous Avons abordé si Fc le phénotype osseux avant same le Debut clinique de la maladie. Nous Avons Fait fait usage de l’observation SELON Laquelle les auto-anticorps apparaissent several Annees avant l’apparition de l’arthrite rhumatoïde et req, DANS CERTAINS CHANGEMENTS particuliers l’apparition osseux précédent clinique de la maladie 28. 29. l de les Lors ‘Fc d’instruction des IgG et APAC sialylation aINSI Que la structure de osseuse Chez personnes en bonne santé autoanticorps positif avant le debut de la polyarthrite rhumatoïde, Nous Avons de nouveau CONSTATE that the Volume osseux et les Numéros trabéculaire are significativement, plus Faibles Chez les personnes à Faible (additional Fig. 5) IgG et juin Faible sialylation APAC comparativement à Ceux Ayant non statut de haute sialylation.

Sialylé APAC their perdent activité pro-ostéoclastogénique

Verser Déterminant si l’association OBSERVEE Entre IgG Fc galactosylation et le volume de osseux is due à effet non directement de l’IgG Fc galactosylation ous tout simplement le fait that the galactose is Nécessaire for the fixation de l’acide sialique aux glycanes IgG, Nous enzymatiquement galactosylée et sialylé Deux Humains monoclonal APAC (clones 109 et C7) (figure additional. 6) Qui were générées à partir de cellules B à partir des articulations des patients atteints de polyarthrite rhumatoïde 30. En cohérence Avec précédemment Données 20. Les Deux clones différenciation des ostéoclastes PROMU (Fig. 4E). Sialylation de bureaux anticorps Ont Donné lieu à juin perte de their activité pro-ostéoclastogénique Au point de same juin légère inhibition de ostéoclastogenèse. En revanche, galactosylation seul, sans sialylation, ne Semble pas Avoir un effet sur les Propriétés ostéoclastogéniques des anticorps. Conformement à CES Résultats, l’analyse de la teneur en acide sialique par galactose sur résidu IgG chez les patients atteints de polyarthrite rhumatoïde en Ontario Montré juin association significative des rate of sialylation, plus Eleves Avec le volume de et trabéculaire Nombre accru d’os (figure additional . 7), Ce Qui suggested Que l’IgG galactosylation is de beaucoup d’importance Moins verser ostéoclastogenèse et la perte osseuse Que IgG sialylation.

N -treatment acétylmannosamine protège les souris contre la CIA

LORs de l’utilisation d’ONU protocole Similaire, des souris nourries with 10 gl -1 significativement de ManNAc apparait, plus élévée de Fc d’IgG1 par le rapport aux souris Témoins Qui have received de l’eau ous 10 gl -1 mannose (fig. 5a). Il y Avait also Un peu plus de galactosylation IgG1 Fc Élevé chez les souris par ManNAc Series, but ACDE n’à pas was significative. treatment ManNAc un conduit à juin, plus l’incidence Faible, l’apparition tardive et les scores D’inférieurs de Arthrite par rapport aux Témoins contestées with de l’eau ous de mannose (Fig. 5b-d). Aucune différence significative de la quantity d’IgG Totales et des anticorps Spécifiques du collagène Entre les Groupes un OBSERVEE ETE, Ce Qui suggested that the treatment ManNAc n’à pas altéré la response immunitaire en général à la base d’IgG (Fig. 5e) . En outré, l’IgG Fc sialylation, maîs pas galactosylation, Était significativement, plus élévée chez les souris Qui développent pas ous l’arthrite légère Que chez les souris Qui Ont Développé juin arthrite sévère (Fig. 5f), Ce Qui suggested Que des levels ainsi Eleves de sialylation Fc des IgG réduisent la sensibilité à l’arthrite expérimentale.

Figure 5: Le treatment par ManNAc AUGMENTE sialylation de IgG1 et la sensibilité Réduit à la CIA.

(juin ) Quantification de sérum totale IgG1 Fc sialylation et galactosylation au jour 32 Chez des Souris et donnes Souris Témoins non-induites induite par LA CIA Recevant non treatment with de l’eau. 10 g l -1 ous mannose 10 g l -1 ManNAc. (b ) Incidence de la CIA. (c ) Les points d’arthrite. ( ) Images représentants des pattes postérieures au jour 32. La barre d’échelle, 5 mm. (e ) Quantification de l’IgG sérique totale et collagène IgG Spécifiques au jour 32. Les barres indiquent la moyenne ± S.E.M. .. DES DONNEES Provenant de deux expériences Indépendantes (non induite par groupe de Contrôle combiné: n = 9; souris TOUS les Autres Groupes: n = 13) souris. (F ) Quantification de sérum totale IgG1 Fc sialylation et galactosylation au jour 32 chez des souris Qui sont RESTES l’arthrite légère Saine ous développés (score 0-4) et de souris Qui Ont Développé juin arthrite sévère (score &# X0003E; 4). Les barres indiquent la moyenne ± S.E.M. .. DES DONNEES COMBINEES de Toutes Les souris Soumises à la CIA (score 0-4: n = 13; Mais &# X0003E; 4: n = 25). L’analyse statistique réalisée was with de Mann-Whitney U -testeur. *P &# X3C; 0,5, **P &# X3C; 0,01.

Figure 6: Le treatment par N -acétylmannosamine (ManNAc) la perte osseuse inhibé arthrite médiée.

(juin ,b ) Représentatifs des reconstructions en 3 dimensions de l’architecture de l’os de la patte de derrière (juin ) Et les os tibial (b ) Des souris non-induite et des Contrôle souris induites Pour l’arthrite induite par le collagène (CIA) traitées with de l’eau. 10 g l -1 ous mannose 10 g l -1 ManNAc. (c ) Paramêtres morphométriques osseuse du tibia Dont trabéculaire et le volume de l’os de volume par corticale de tissu (TBV / TV; CBV / TV) et trabéculaire et de la densité minérale osseuse corticale (TBMD; cBMD). Les barres indiquent la moyenne ± S.E.M. .. Une expérience représentative (non induit groupe témoin: n = 5; souris eau groupe Traité: n = 7; souris TOUS les Autres Groupes n = 6 souris). ( ) Images de représentants TRAP -stained sections de patte. Barre d’échelle, 200 um. (e ) paramêtres histologiques des Pattes arrieres y COMPRIS la zone par zone de Tissu (E.Ar/T.Ar~~number=plural) ET Le Nombre D’ostéoclastes zone par de Tissu (N.Oc / T.Ar) ÉRODE. Les barres indiquent la moyenne ± S.E.M. .. DES DONNEES Provenant de deux expériences Indépendantes (non induite par groupe de Contrôle combiné: n = 9; souris TOUS les Autres Groupes: n = 13) souris. L’analyse statistique réalisée was with de Mann-Whitney U -testeur. **P &# X3C; 0,01.

Dans Les Dernières Années, il y a eu several études Avec des resultats Controverses concerning les Effets des sur la ostéoclastogenèse de complexes 17. 19. 33. Bien Que la réticulation de FcyR was jugée favorable verser ostéoclastogenèse 19. Il était difficile de savoir si la liaison de complexes immuns a le same effet. Ici, Nous montrons that the degré d’IgG sialylation is D’une importance majeure verser les complexes-ostéoclastes interactions immunitaires et Que les complexes only Faible UO de non sialylées CONDUIRE ostéoclastogenèse in vitro also bien Que in vivo,. Utilisation aléatoire IgG, nous avons encore démontré Que l’effet pro-ostéoclastogénique de complexes non sialylé immunitaires ne se limite pas aux Spécificités antigéniques distinctes, but juin characteristic commune de Tous les anticorps IgG.

Sur la base de nos de Données, Nous émettons l’hypothèse Que l’improvement de l’IgG sialylation can be juin strategy de treatment verser la perte osseuse inhiber auto-immune. Pour tester this hypothèse, Nous Avons used le précurseur d’acide sialique ManNAc. Qui est juin approach Intéressante voiture Elle can be reprise par voie orale, was démontré Que l’incidence des myopathies Liées Ë hyposialylation 32 et Amélioré la protéine globale sialylation 36. En effet, les souris induites par la CIA Qui were with ManNAc nourris Une augmentation significative affichent des IgG sialylation par rapport with des souris Qui have received de l’eau ous solution juin mannose. Le treatment with ManNAc non only gave lieu à un cours mitigé de l’arthrite, Mais aussi bloqué ostéoclastogenèse inflammatoire et Une érosion osseuse. Que CE Soit juin Telle approche is in the treatment Efficace de l’arthrite rhumatoïde et Emerge Comme une approche de treatment, plus réalisable Que d’immunoglobulines coûteuses perfusions intraveineuses, Qui Ont Montré juin Efficacité in the treatment de la polyarthrite rhumatoïde 37. 38. Cependant , reste à DETERMINER.

En résumé, nos Données montrent Que, en dehors de la régulation des des fonctions de effectrices, IgG sialylation Contrôle la différenciation des ostéoclastes et la masse osseuse chez les souris et les Humains pointant vers Un nouveau privilège between the system immunitaire adaptatif et d’os with directe de pertinence Pour la maladie humaine.

Désialylation et la déglycosylation des IgG et de génération IC

Galactosylation et de sialylation d’anticorps monoclonaux

Monoclonales APAC des clones 109 et des anticorps C7 ET anti-TNP were Generes COMME decrit 30. 39. Ailleurs Verser galactosylation, 1 mg d’IgG was incube with 10 uM UDP-galactose (Calbiochem) ET 2,5 mU de ß1 – 4 galactosyltransférase (Sigma) Dans 50 mM MOPS. pH 7,2 mM MnCl 202 Pendentif 48 h à 37 ° C Pour la sialylation, 1 mg d’IgG was mis en incubation with 10 uM de l’acide CMP-sialique (Calbiochem) et 10 mU de sialyltransférase α2-6 (Sigma) Dans 50 mM de MES. pH 6,0 mM MnCl 102 Pendentif 48 h à 37 ° C. Les réactions were Confirmees par non blot de lectine.

blot lectine

Les Mesures de diffusion de la lumière dynamique,

diffusion de lumière dynamique angulaire dépendante was réalisée en Utilisant non nm Laser 6328 et non CGS3-goniomètre (ALV) à juin température de 20 ° C Avec Deux Détecteurs à diode avalanche et corrélateur non ALV-5000 with 320 Canaux sous corrélation croisée. Une gamme de diffusion de 30 ° anges&# X3C; θ&# X3C; 150 ° was recouvert de 10 °. fonctions d’autocorrélation d’intensité were cessionnaires Dans des fonctions d’autocorrélation du champ électrique par rapport Siegert, Puis Transformes en la répartition des Temps de relaxation UNE (τ ) Transformation Régulariser Par l’intermédiaire de Laplace. Résultante des temps de relaxation means de verser angle each were transferes in the coefficient de diffusion apparent app. Qui a ensuite extrapolés à l’Été angle zéro de diffusion (diffusion carré de vecteur); le Résultat extrapolée une salle Donné le rayon hydrodynamique RH à l’égard de Travers juin de Stokes-Einstein.

La génération et la stimulation de pré-ostéoclastes

Pour le dosage de résorption, préostéoclastes Humains were générées et stimulées par les des complexes de IgG sur des plaques revêtues de phosphate de calcium (Corning) Dans les conditions Mêmes Que Celles décrites ci-dessus. Résorption was visualisée par coloration de juin von Kossa. En bref, Nous Lyse les cellules with de l’eau et sur incube les puits pendant 30 min avec 5% de nitrate d’argent. Après lavage intensif, la coloration à l’argent was developpee pendant 1 min with du carbonate de sodium à 5% à 25% de formaldéhyde et de l’argent Qui n’a pas réagi was Elimine with du thiosulfate de sodium à 5 % pendant 5 min. Pour l’évaluation, les photos were Prises et le pourcentage, de la zone résorbée was Calculated with Adobe Photoshop CS5 Extended.

Le blocage des Récepteurs Fcy

immunofluorescence

l’isolement de l’ARN et l’analyse quantitative RT-PCR

Ostéoclastes were différenciées à partir de monocytes Humains, Comme decrit ci-dessus. Directement après l’isolement des monocytes OÜ activités après divers temps de culture, l’ARN totale was extrait with peqGOLD Trifast (Peqlab): selon les instructions Du fabricant. L’ARN was transcrit en ADNc en Utilisant des oligo (dT) et des amorces de transcriptase inverse MuLV (Roche). PCR quantitative en temps réel was réalisée with SYBR Green I-dTTP (Eurogentec) et les paires d’amorces Suivantes: β2-microglobuline (β2-MG) vers l’avant 5’GATGAGTATGCCTGCCGTGTG -3 ‘et β2-MG inverse 5 ‘- CAATCCAAATGCGGCATCT -3’, fcγr1 avant 5’GTGTCATGCGTGGAAGGATA -3 ‘et fcγr1 Inverser 5’GCACTGGAGCTGGAAATAGC -3 ‘, fcγr2a avant 5’CCAGCATGGGCAGCTCTTCACC -3 ‘et fcγr2a Inverser 5’TGGGCAGCCTTCACAGGATCA -3 ‘, fcγr2b avant 5’GCGGCCATTGTTGCTGCTGTA -3 ‘et fcγr2b Inverser 5’AGAGCATCCGGGTGCATGAGA -3 ‘, fcγr3 avant 5’ACAGGTGCCAGACAAACCTC -3 ‘ fcγr3 Inverser 5’TTCCAGCTGTGACACCTCAG -3 ‘, FcRy avant 5’TGATTCCAGCAGTGGTCTTGCTCT -3 ‘et FcRy Inverser 5’ATGCAGGCATATGTGATGCCAACC -3 ‘, DAP12 Transmettre 5’CAGCGACCCGGAAACAGCGT -3 ‘et DAP12 Inverser 5’CGGCCTCTGTGTGTTGAGGTCG -3 ‘.

intra-articulaire injection de complexes immuns

L’induction de la CIA et le treatment with N -acétylmannosamine

modèle de transfert de l’arthrite induite par antigène non

mBSA (2 mg ml -1; Sigma) was émulsionnée en Quantités égales with adjuvant complet de Freund (Sigma) du contenant 5 mg ml -1 inactivé à la chaleur Mycobacterium tuberculosis (H37Ra, Difco). Mâle 6 semaines Balb / c Femelles (Janvier) were s.c. injectées with 100 ul of this émulsion et sur l’injecte simultanément i.p. avec 5 x 10 8 inactivé à la chaleur Bordtella pertussis (Institut national des Normes biologiques et de Contrôle (NIBSC)) au jour 0 ET 7. Après 21 jours, les souris were with 100 pg contestées mBSA en Une Seule l’articulation du genou. Au jour 28, le sang prélevé et was IgG was isolated Avec Une colonne de protéine G (GE Healthcare): selon les instructions Du fabricant. Verser la sialylation, 1 mg d’IgG was mis en incubation with 750 pM de l’acide CMP-sialique (Calbiochem) et 30 mU de sialyltransférase α2-6 (Sigma) Dans du Tris / HCl 100 pH 8,0 with 1 mM MnCl2 Pendentif 4 jours à 37 ° C La réaction was non confirmée par blot de lectine. Verser le transfert IgG, 2 mg de non traitee AIA-IgG de ous were injectés nominale Voie intraveineuse en Mâle de 9 Semaines souris Agées naïve Balb / c (Janvier). Après 1 et 5 jours, les articulations du genou droit were with 100 ug injectées mBSA. L’articulation du genou gauche a servi de interne de Contrôle. Gonflement des articulations du genou was specified à l’aide d’Une jauge d’Épaisseur à cadran (Peacock) et exprimee par rapport au diamètre du genou au jour 0. Au jour 8, les souris were tuées et les os were disséqués Pour l’analyse histologique.

La mesure des concentrations d’IgG in the sérum de la souris

Les concentrations sériques d’IgG were mesurées with a dosage immuno-enzymatique (ELISA) kit de quantification (Bethyl Laboratories). Pour l’évaluation de l’IgG Spécifique à du collagène, des plaques were revêtues with 10 pg ml-1 de poulet de collagène de type II (Sigma) à La place de l’anticorps de capture.

Histologie

Bones were Correctifs verser 6 h à 4% de formaline et décalcifiées Dans de l’EDTA (Sigma-Aldrich). coupes de paraffine série (2 heures) were colorées verser TRAP en Utilisant non kit de phosphatase acide leucocytaire (Sigma) SELON LES instructions DU fabricant ous with de l’hématoxyline – éosine. Toutes les analyses were effectuees en Utilisant un microscope non (Nikon) ÉQUIPÉ D’une caméra numérique et d’analyse A system d’image de verser éffectuer histomorphométrie (Osteomeasure; OsteoMetrics).

Micro-tomographie par ordinateur de souris

μCT analyses were réalisées with a Scanco médical μCT 40 scanner en Utilisant les paramêtres Suivants: tension, 40 kV; courant X-ray, 250 uA; temps d’exposition, 5000 ms / projection verser 720 projections; matrice, 1,024 × 1,024; taille de voxel Dans l’image reconstruite, 21:00. Les images were analysées with a logiciel d’évaluation verser des paramêtres Scanco à la métaphyse du tibia proximal: le rapport du volume de osseux au volume total, le Nombre trabéculaire et l’trabéculaire Épaisseur.

Les patients

Micro-tomodensitométrie Chez les patients

IgG isolement

procession et analyser des Données statistiques

  • abstrait •
  • introduction •
  • Résultats •
  • Discussion •
  • Méthodes •
  • information additionnelle •
  • Les références •
  • Remerciements •
  • Informations sur l’auteur •
  • Informations additional
  1. Arnold, J. N. Wormald, M. R. Sim, R. B. Rudd, P. M. & Dwek, R. A. L’incidence de glycosylation sur la fonction biologique et la structure de des immunoglobulines humaines. Annu. Rev. Immunol. 25. 21-50 (2007).
    • CAS
    • ISI
    • PubMed
    • Article
    • Anthony, R. M. & Nimmerjahn F. Le rôle du différentiel IgG glycosylation Dans l’interaction d’anticorps with FcgammaRs in vivo. Curr. Opin. Greffe d’organe. 16. 7 – 14 (2011).
    • Yamaguchi, Y. et al. Glycoforme personne à charge de la modification conformationnelle de la région Fc de l’immunoglobuline G1 humaine Telle Que révélée par spectroscopie RMN. Biochim. Biophys. Acta. 1760. 693 – 700 (2006).
      • CAS
      • ISI
      • PubMed
      • Anthony, R. M. et al. Récapitulation de l’activité anti-inflammatoire IVIG Avec Une IgG Fc recombinant. Sciences 320. 373-376 (2008).
        • CAS
        • ISI
        • PubMed
        • Article
        • Bohm, S. Schwab, I. Lux, A. & Nimmerjahn, F. Le rôle de l’acide sialique en Tant que modulator de l’activité anti-inflammatoire des IgG. Semin. Immunopathol. 34. 443-453 (2012).
        • Scallon, B. J. Tam, S. H. McCarthy, S. G. Cai, A. N. & Raju, levels T. S., plus Eleves de glycanes Fc sialylées en immunoglobulines G molécules may la défavorablement Fonctionnalité d’impact. Mol. Immunol. 44. 1524-1534 (2007).
          • CAS
          • ISI
          • PubMed
          • Article
          • Kaneko, Y. Nimmerjahn, F. & Ravetch, activité J. V. Anti-inflammatoires de l’immunoglobuline G Résultante de Fc sialylation. Sciences 313. 670-673 (2006).
            • CAS
            • ISI
            • PubMed
            • Article
            • Campbell, I. K. et al. L’effet thérapeutique des IgIV sur l’arthrite inflammatoire chez la souris is dépendante de la portion Fc ET indépendante de La sialylation basophiles de UO. J. Immunol. 192. 5031 – 5038 (2014).
              • CAS
              • ISI
              • PubMed
              • Article
              • Anthony, R. M. Wermeling, F. Karlsson, M. C. & Ravetch, J. V. Identification d’ONU récepteur Nécessaire versez l’activité anti-inflammatoire des IgIV. Proc. Acad. Sci. États-Unis 105. 19571 à 19578 (2008).
                • PubMed
                • Article
                • Massoud, A. H. et al. immunorécepteur cellulaire dendritique: Un nouveau récepteur Pour l’immunoglobuline intraveineuse medie L’induction de Cellules T régulatrices. J. Allergy Clin. Immunol. 133. 853-863 E855 (2014).
                  • CAS
                  • PubMed
                  • Article
                  • Sondermann, P. Pincetic, A. Maamary, J. Lammens, K. & Ravetch, mechanism J. V. général verser Moduler la fonction immunoglobuline effecteur. Proc. Acad. Sci. USA 110. 9868 – 9872 (2013).
                    • PubMed
                    • Article
                    • Yu, X. Vasiljevic, S. Mitchell, D. A. Crispin, M. & Scanlan, C. N. disséquant le mechanism moléculaire de IgIV: l’interaction Entre des IgG sériques et DC-SIGN is indépendante de la glycoforme d’anticorps non OÜ domaine Fc. J. Mol. Biol. 425. 1253 – 1258 (2013).
                      • CAS
                      • PubMed
                      • Article
                      • Braun, T. & Zwerina, REGULATEURS J. Positifs de ostéoclastogenèse et la résorption osseuse Dans la polyarthrite rhumatoïde. Res de l’arthrite. Ther. 13. 235 (2011).
                        • CAS
                        • PubMed
                        • Article
                        • Zhao, B. & Ivashkiv, L. B. régulation négative de l’ostéoclastogenèse et la résorption osseuse par des cytokines et répresseurs de la transcription. Res de l’arthrite. Ther. 13. 234 (2011).
                          • CAS
                          • PubMed
                          • Article
                          • Koga, T. et al. Signaux de costimulation médiée par le motif ITAM coopèrent with RANKL verser homéostasie osseuse. Nature 428. 758-763 (2004).
                            • CAS
                            • ISI
                            • PubMed
                            • Article
                            • Hayashi, M. et al. Osteoprotection par sémaphorine 3A. Nature 485. 69-74 (2012).
                              • CAS
                              • ISI
                              • PubMed
                              • Article
                              • Grevers, L. C. et al. inhibition immunitaire induite par complexe de ostéoclastogenèse is médiée l’activation par des Récepteurs Mais pas Fcgamma Inhibiteurs sur les cellules myéloïdes Précurseurs. Ann. Rhume. Dis. 72. 278-285 (2013).
                              • Harre, U. et al. ostéoclastes Moonlighting Comme entrepreneurs de Cellules apoptotiques. Autoimmunité 45. 612-619 (2012).
                                • PubMed
                                • Article
                                • Seeling, M. et al. monocytes inflammatoires et Fcgamma récepteur IV sur les ostéoclastes are Essentiels for the destruction de l’os pendant l’arthrite inflammatoire chez les souris. Proc. Acad. Sci. ETATS-UNIS. 110. 10729-10734 (2013).
                                  • PubMed
                                  • Article
                                  • Harre, U. et al. L’induction de l’ostéoclastogenèse et la perte osseuse par des autoanticorps Humains contre vimentine citrullines. J. Clin. Investir. 122. 1791 – 1802 (2012).
                                    • CAS
                                    • ISI
                                    • PubMed
                                    • Article
                                    • Scherer, H. U. et al. Le profilage des glycanes des anticorps anti-Protéines citrullinées isolées à partir de sérum humain et le liquide synovial. Arthritis Rheum. 62. 1620-1629 (2010).
                                      • CAS
                                      • ISI
                                      • PubMed
                                      • Article
                                      • Henson, P. M. & Spiegelberg, H. L. libération de sérotonine par les plaquettes humaines induites Par les immunoglobulines agrégées de Différentes classes d ‘ET sous-classes. J. Clin. Investir. 52. 1282 à 1288 (1973).
                                        • CAS
                                        • ISI
                                        • PubMed
                                        • Ji, H. et al. L’arthrite Dépend de Façon critique sur les Acteurs du Système immunitaire inné. 16. 157-168 immunité (2002).
                                          • CAS
                                          • ISI
                                          • PubMed
                                          • Article
                                          • Zhao, X. et al. Complexes immuns circulants du fibrinogène contiennent citrulline Dans la polyarthrite rhumatoïde. Res de l’arthrite. Ther. 10. R94 (2008).
                                            • CAS
                                            • PubMed
                                            • Article
                                            • Van Steendam, K. et al. vimentine citrullines Comme antigène non importante Dans les complexes immuns de liquide synovial de patients atteints de polyarthrite rhumatoïde Avec des anticorps contre les Protéines citrullines. Res de l’arthrite. Ther. 12. R132 (2010).
                                            • Mathsson, L. Lampa, J. Mullazehi, M. & Ronnelid, J. complexes immuns de la polyarthrite rhumatoïde liquide synovial le facteur induire personne à charge de la production et de la polyarthrite FcgammaRIIa corrélation de facteur de nécrose tumorale-alpha par les cellules mononucléaires du sang périphérique. Res de l’arthrite. Ther. 8. R64 (2006).
                                            • Collins, S. E. et al. l’état de glycosylation de sérum Dans l’arthrite inflammatoire, en response à treatment non anti-TNF. Rhumatologie 52. 1572-1582 (2013).
                                            • Rantapaa-Dahlqvist, S. et al. Les anticorps Dirigés contre le peptide cyclique citrulline et IgA du facteur rhumatoïde prédire le développe- ment de la polyarthrite rhumatoïde. Arthritis Rheum. 48. 2741 à 2749 (2003).
                                              • CAS
                                              • ISI
                                              • PubMed
                                              • Article
                                              • Kleyer, A. et al. La perte osseuse avant l’apparition clinique de la polyarthrite rhumatoïde chez des Sujets presentant des anticorps de la protéine anticitrullinated. Ann. Rhume. Dis. 73. 854-860 (2014).
                                                • ISI
                                                • PubMed
                                                • Article
                                                • Amara, K. et al. des anticorps monoclonaux IgG Generes à partir de cellules B conjointes Dérivées de PR de patients en Ontario Une forte tendance vers la reconnaissance de autoantigène citrullinated. J. Exp. Med. 210. 445-455 (2013).
                                                  • CAS
                                                  • ISI
                                                  • PubMed
                                                  • Article
                                                  • Keppler, O. T. et al. UDP-GlcNAc 2-épimérase: un régulateur de sialylation de la surface cellulaire. Sciences 284. 1372-1376 (1999).
                                                    • CAS
                                                    • ISI
                                                    • PubMed
                                                    • Article
                                                    • Galeano, B. et al. Mutation Dans l’enzyme clé de la biosynthèse de l’acide sialique de tombes protéinurie compositions provoquent glomérulaire et par is sauvé N-acétylmannosamine. J. Clin. Investir. 117. 1585 – 1594 (2007).
                                                      • CAS
                                                      • ISI
                                                      • PubMed
                                                      • Article
                                                      • MacLellan, L. M. et al. Cooptation immunoglobuline Endogene verser la régulation de l’inflammation et de l’ostéoclastogenèse chez les Humains et les souris. Arthritis Rheum. 63. 3897-3907 (2011).
                                                        • ISI
                                                        • PubMed
                                                        • Article
                                                        • van Gaalen, F. A. et al. Autoanticorps aux peptides cycliques citrullines prédisent la progression de la polyarthrite rhumatoïde chez les patients Souffrant d’arthrite indifférenciée: une Étude de cohorte prospective. Arthritis Rheum. 50. 709-715 (2004).
                                                          • CAS
                                                          • ISI
                                                          • PubMed
                                                          • Article
                                                          • Saeki, Y. et al. anticorps anti-peptide citrulline Baseline (APAC) et des titres sériques d’interleukine-6 ​​(IL-6) levels may la progression de prédire la destruction osseuse Dans Les stades précoces de la polyarthrite rhumatoïde (ERA). Rheumatol. Int. 33. 451-456 (2013).
                                                          • Gagiannis, D. Gossrau, R. Reutter, W. Zimmermann-Kordmann, M. & Horstkorte, R. génie de l’acide sialique Dans les Organes de souris à l’aide de N-propanoylmannosamine. Biochim. Biophys. Acta 1770. 297 – 306 (2007).
                                                            • CAS
                                                            • PubMed
                                                            • Tumiati, B. Casoli, P. Veneziani, M. & Rinaldi, G. treatment à fortes doses d’immunoglobulines Comme un treatment immunomodulateur de l’arthrite rhumatoïde. Arthritis Rheum. 35. 1126-1133 (1992).
                                                            • Muscat, C. et al. Le treatment à longue terme de la polyarthrite rhumatoïde Avec des doses élevées d’immunoglobulines intraveineuses: Effets Sur L’activité de La Maladie Et De Sérum cytokines. Ann. Rhume. Dis. 54. 382-385 (1995).
                                                            • Lux, A. Yu, X. Scanlan, C. N. & Nimmerjahn, F. Impact de la taille complexe immun et glycosylation sur IgG soi Liant Ë FcgammaRs humaines. J. Immunol. 190. 4315 – 4323 (2013).
                                                              • CAS
                                                              • PubMed
                                                              • Article
                                                              • Boutroy, S. Bouxsein, M. L. Munoz, F. & Delmas, P. D. Dans l’évaluation in vivo de la microarchitecture osseuse trabéculaire par haute résolution tomodensitométrie quantitative périphérique. J. Clin. Endocrinol. Metab. 90. 6508 à 6515 (2005).
                                                                • CAS
                                                                • PubMed
                                                                • Article
                                                                • Selman, M. H. et al. glycosylation Profilage par nano robuste en phase inverse HPLC-MS en Utilisant l’interface ESI juin Pulvérisateur gaine-débit de Fc des IgG. J. Proteomics 75. 1318-1329 (2012).

                                                                Affiliations

                                                                Département de médecine interne 3, Université d’Erlangen-Nuremberg, Erlangen 91054, Allemagne

                                                                • Ulrike Harre,
                                                                • Stefanie C. Lang,
                                                                • René Pfeifle,
                                                                • Wolfgang Baum,
                                                                • Katharina Dietel,
                                                                • Roland Kocijan,
                                                                • Martin Herrmann &
                                                                • Georg Schett
                                                              • Nikolaus Fiebiger Centre de médecine moléculaire, Université de Erlangen-Nuremberg, Erlangen 91054, Allemagne

                                                                Service de Rhumatologie, Centre médical de l’Université de Leiden, Leiden 2300 RC, Pays-Bas

                                                                • Yoann Rombouts,
                                                                • Carolien A. Koeleman,
                                                                • René E. M. Toes &
                                                                • Hans Ulrich Scherer
                                                                • Centre de protéomique et métabolomique, Leiden University Medical Center, Leiden 2300 RC, Pays-Bas

                                                                  Département de chimie et de pharmacie, Centre interdisciplinaire de Matériaux Moléculaires (CIMM), Université d’Erlangen-Nuremberg, Erlangen 91054, Allemagne

                                                                  Unité de rhumatologie, département de médecine, Institut Karolinska et de l’hôpital universitaire Karolinska, Solna 17177, Suède

                                                                  Orgentec Diagnostika, Mainz 55129, Allemagne

                                                                  Département de Génétique, Université d’Erlangen-Nuremberg, Erlangen 91054, Allemagne

                                                                  Contributions

                                                                  U.H. M.H. et G.S. designed et réalisé des expériences et ANALYSER les Données. U.H. S.C.L. W.B. et K.D. Expérimentations animales réalisées. R.P. et A.L. Ont contribué à la modification enzymatique des IgG. S.F. et F.G. Exécuté et ANALYSER les Mesures dynamiques de diffusion de la lumière. K.A. V.M. et L.K. Généré et APAC monoclonal Fourni. Y.R. C.A.K. R.E.M.T. et H.U.S. isolé et ANALYSER IgG Provenant de sérums. H.B. G.K. F.N. et M.H. Fourni du matériel et Précieux apport intellectuel. U.H. et G.S. a Écrit le manuscrit.

                                                                  Competing Intérêts financiers

                                                                  Les auteurs déclarent juin absence d’intérets financiers en compétition.

                                                                  auteur correspondant

                                                                • RELATED POSTS

                                                                  Laisser un commentaire